I have invented LeetSpeak 2
#14
Moonlapse Wrote:I say we write in DNA:

AGGTCCAGCTACGATTCGATTCGGATCGGATCGGATGCGATCGGATGCTG

0101001101110000011001010110000101101011011010010110111001100111001000000110100101101110001000000110001001101001011011100110000101110010011110010010000001101001011100110010000001110111011000010111100100100000011000110110111101101111011011000110010101110010
Reply


Messages In This Thread
I have invented LeetSpeak 2 - by Satellite - 2010-11-13, 09:20 AM
I have invented LeetSpeak 2 - by Link - 2010-11-13, 09:22 AM
I have invented LeetSpeak 2 - by Fiel - 2010-11-13, 09:24 AM
I have invented LeetSpeak 2 - by Satellite - 2010-11-13, 12:56 PM
I have invented LeetSpeak 2 - by Erebus - 2010-11-13, 01:06 PM
I have invented LeetSpeak 2 - by Satellite - 2010-11-13, 01:11 PM
I have invented LeetSpeak 2 - by Erebus - 2010-11-13, 01:12 PM
I have invented LeetSpeak 2 - by Fiel - 2010-11-13, 01:22 PM
I have invented LeetSpeak 2 - by Hanabira.Kage - 2010-11-14, 08:06 AM
I have invented LeetSpeak 2 - by Locked - 2010-11-14, 09:03 AM
I have invented LeetSpeak 2 - by Myles - 2010-11-14, 09:20 AM
I have invented LeetSpeak 2 - by Link - 2010-11-14, 09:49 AM
I have invented LeetSpeak 2 - by Moonlapse - 2010-11-14, 07:41 PM
I have invented LeetSpeak 2 - by Erebus - 2010-11-14, 07:46 PM
I have invented LeetSpeak 2 - by Mark - 2010-11-14, 08:51 PM
I have invented LeetSpeak 2 - by Solarboy - 2010-11-14, 10:11 PM
I have invented LeetSpeak 2 - by Russt - 2010-11-14, 10:47 PM
I have invented LeetSpeak 2 - by Raph589 - 2010-11-14, 11:01 PM
I have invented LeetSpeak 2 - by octopusprime - 2010-11-14, 11:02 PM
I have invented LeetSpeak 2 - by Tay - 2010-11-14, 11:10 PM
I have invented LeetSpeak 2 - by octopusprime - 2010-11-14, 11:40 PM
I have invented LeetSpeak 2 - by Kojo - 2010-11-15, 12:23 PM
I have invented LeetSpeak 2 - by Satellite - 2010-11-15, 12:49 PM

Forum Jump:


Users browsing this thread: 1 Guest(s)