I have invented LeetSpeak 2

Linear Mode

I have invented LeetSpeak 2

~~Erebus~~

Won't Be Coming Back

Posts: 738
Threads: 107
Joined: 2010-04

#14

2010-11-14, 07:46 PM

Moonlapse Wrote:I say we write in DNA:

AGGTCCAGCTACGATTCGATTCGGATCGGATCGGATGCGATCGGATGCTG

0101001101110000011001010110000101101011011010010110111001100111001000000110100101101110001000000110001001101001011011100110000101110010011110010010000001101001011100110010000001110111011000010111100100100000011000110110111101101111011011000110010101110010

Find

« Next Oldest | Next Newest »

Messages In This Thread

I have invented LeetSpeak 2 - by Satellite - 2010-11-13, 09:20 AM

I have invented LeetSpeak 2 - by Link - 2010-11-13, 09:22 AM

I have invented LeetSpeak 2 - by Fiel - 2010-11-13, 09:24 AM

I have invented LeetSpeak 2 - by Satellite - 2010-11-13, 12:56 PM

I have invented LeetSpeak 2 - by Erebus - 2010-11-13, 01:06 PM

I have invented LeetSpeak 2 - by Satellite - 2010-11-13, 01:11 PM

I have invented LeetSpeak 2 - by Erebus - 2010-11-13, 01:12 PM

I have invented LeetSpeak 2 - by Fiel - 2010-11-13, 01:22 PM

I have invented LeetSpeak 2 - by Hanabira.Kage - 2010-11-14, 08:06 AM